View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7405_low_12 (Length: 387)
Name: NF7405_low_12
Description: NF7405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7405_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 74 - 380
Target Start/End: Complemental strand, 45441560 - 45441263
Alignment:
| Q |
74 |
gtaggaaggtcagggacgacagaataggaaattggctgtggcccaccacaagcgccgtagtgggaggtctcacttcacagttgctcaaaatctcaaagga |
173 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45441560 |
gtaggaaggtcatggacgacagaataggaaattggctgttgcccaccacaagcgccgtagtgggaggtctcacttcacagttgctcaaaatctcaaagga |
45441461 |
T |
 |
| Q |
174 |
ctactctccaattctcatgatgatgatgatacttttctcggtacagtaacctcaaacctcaccggctcaaaataccacatttgggatcagggatatcatc |
273 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45441460 |
ctactctccaattctcatgatgatgat---acttttctcgggacagtaacctcaaacctcaccggctcaaaataccacatttgggatcagggatatcatc |
45441364 |
T |
 |
| Q |
274 |
gccataagccccgtagtaaaccacctcttgctgttgttgagtaagcctaaatcttccttcatctttctctttctcaatctccccctcggcttcattcttc |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
45441363 |
gccataagccccgtagtaaaccacctcttgctgttgttgagtaagcctaaatcttccttcatctt------tctcaatctccccctcgtcttcattcttc |
45441270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 45441613 - 45441581
Alignment:
| Q |
18 |
aatatcactttgctattaagtaagactcacatg |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45441613 |
aatatcactttgctattaagtaagactcacatg |
45441581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University