View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7405_low_24 (Length: 230)
Name: NF7405_low_24
Description: NF7405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7405_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 26955397 - 26955190
Alignment:
| Q |
1 |
tggtgagagaactcatagatcgaagctcttaatagttcttaatcactacaaaataaccgtgtgataattatgataataaatagtgaaagaattatgcact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26955397 |
tggtgagagaactcatagatcgaagctcttaatagctcttaattactacaatataaccgtgtgataattatgataataaatagtgaaagaattatgcact |
26955298 |
T |
 |
| Q |
101 |
accagctgatcaaacacgccccttgcaagattggagtgtcgtgaatagttttgatcttgtttcttagatgttgatgacggaattttgagagaggtttggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26955297 |
accagctgatcaaacacgccccttgcaagattggagtgtcgagaatagttttgatcttgtttcttagatgttgatgacggaattttgagagaggtttggt |
26955198 |
T |
 |
| Q |
201 |
gaaacaat |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
26955197 |
gaaacaat |
26955190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 29251646 - 29251698
Alignment:
| Q |
126 |
caagattggagtgtcgtgaatagttttgatcttgtttcttagatgttgatgac |
178 |
Q |
| |
|
|||||||| |||||||| | || | ||||||||||||||||||||||||||| |
|
|
| T |
29251646 |
caagattgaagtgtcgttagtaactctgatcttgtttcttagatgttgatgac |
29251698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University