View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7405_low_25 (Length: 230)
Name: NF7405_low_25
Description: NF7405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7405_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 73 - 220
Target Start/End: Original strand, 34112734 - 34112881
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatccannnnnnnngcactatgaaccccctt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
34112734 |
cagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatccattttttttgcactatgaatcccctt |
34112833 |
T |
 |
| Q |
173 |
agnnnnnnnnattgcataccctcaacttttatctgcactttcatctca |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34112834 |
agttttttttattgcataccctcaacttttatctgcactttcaactca |
34112881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 73 - 220
Target Start/End: Original strand, 12470314 - 12470462
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatcc-annnnnnnngcactatgaaccccct |
171 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
12470314 |
cagtggcggagccacgtacaagtcaggggatgcacatgcatcctctcaacttttgaaaaatacaccaataatccaattttttttgcactatgaaccccct |
12470413 |
T |
 |
| Q |
172 |
tagnnnnnnnnattgcataccctcaacttttatctgcactttcatctca |
220 |
Q |
| |
|
||| |||||||||||||||| ||||| |||||||||| |||| |
|
|
| T |
12470414 |
tagttttttttattgcataccctcaacctttatttgcactttcaactca |
12470462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 73 - 220
Target Start/End: Complemental strand, 34306618 - 34306471
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatccannnnnnnngcactatgaaccccctt |
172 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34306618 |
cagtggcggagccacgtacaagtcaggggatgcacatgcatcctctcaacttttgaaaaatacaccaataatccaatttttttgcactatgaaccccctt |
34306519 |
T |
 |
| Q |
173 |
agnnnnnnnnattgcataccctcaacttttatctgcactttcatctca |
220 |
Q |
| |
|
|| |||||||||||||||| ||||| | |||||||| |||| |
|
|
| T |
34306518 |
agttttttttattgcataccctcaacctttatttacactttcaactca |
34306471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 113
Target Start/End: Original strand, 8366222 - 8366265
Alignment:
| Q |
70 |
aaccagtggcggagccacatacaagttaggggatgcacatgcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
8366222 |
aaccagtggcggagccacatacaagtgaggggatgcagatgcat |
8366265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 72 - 147
Target Start/End: Original strand, 33829827 - 33829902
Alignment:
| Q |
72 |
ccagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatcca |
147 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33829827 |
ccagtggcggagccacgtacaagtcaggggatgcacatgcatcctctcaacttttgaaaaatacaccaataatcca |
33829902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 70 - 147
Target Start/End: Original strand, 37503380 - 37503456
Alignment:
| Q |
70 |
aaccagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaaaatacaccaataatcca |
147 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||| | ||||||||| |||||| ||||||||||||| |
|
|
| T |
37503380 |
aaccagtggcggagccacctacaagtcaggggatgcacatgcatac-ctcaactttagaaaaatgcaccaataatcca |
37503456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 73 - 115
Target Start/End: Complemental strand, 24857396 - 24857354
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcc |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24857396 |
cagtggcggagccacatacaagtgaggggatgcagatgcatcc |
24857354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 113
Target Start/End: Original strand, 25267846 - 25267886
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcat |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
25267846 |
cagtggcggagccacatacaagtgaggggatgcaaatgcat |
25267886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 115
Target Start/End: Complemental strand, 8078541 - 8078499
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcc |
115 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
8078541 |
cagtggcggtgccacatacaagtgaggggatgcagatgcatcc |
8078499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 130
Target Start/End: Original strand, 21466414 - 21466471
Alignment:
| Q |
73 |
cagtggcggagccacatacaagttaggggatgcacatgcatcctctcaacttttaaaa |
130 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| ||||||| || | ||||||||| |
|
|
| T |
21466414 |
cagtggcggtgccacatataagtgaggggatgcacttgcatcccctgatcttttaaaa |
21466471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University