View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7406_high_14 (Length: 432)
Name: NF7406_high_14
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7406_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 82 - 405
Target Start/End: Original strand, 33616863 - 33617207
Alignment:
| Q |
82 |
atatgatctcaattctcaaagtataaagttattttccttaagtttcaagcaaggacaatatgaaaatcagtgaaaattctgaaaattttaaattggttag |
181 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33616863 |
atatgatctcaattctcgaagtataaagttattttccttaagtttcaagcaaggacaatatgaaaatcagtgaaaattctgaaaattttaaattggttaa |
33616962 |
T |
 |
| Q |
182 |
gtgattagcgttttcactttagcacttcaaacaagcatttaagtaaaaa--ttgcatccaagaacaat-------------------gttaaacttttag |
260 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
33616963 |
gtgattagccttttcactttagcacttcaaacaagcatttaagtaaaaaaattgcatccaagaacaatattttgttcacataataatgttaaacttttag |
33617062 |
T |
 |
| Q |
261 |
gattgctatgtgacaattgtgtactctagtatatataacattgaagatgaattacaataaactctgaattaacataatgtctacaaaaacagtgaagttc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33617063 |
gattgctatgtgacaattgtgtactctagtatatataacattgaagatgaattacaataaactctgaattaacataatgtctacaaaaacagtgaagttc |
33617162 |
T |
 |
| Q |
361 |
agttgcattctgactccactttccataaaatttatttctcccccc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33617163 |
agttgcattctgactccactttccataaaatttatttctcccccc |
33617207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 27 - 88
Target Start/End: Original strand, 33616003 - 33616064
Alignment:
| Q |
27 |
ttttttggatgtagaaaatatacaagctattacctcttgccaacttatcactattatatgat |
88 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33616003 |
ttttttggatgtagaaaatatacaagccattacctcttgccaacttatcactattatatgat |
33616064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University