View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7406_high_22 (Length: 329)
Name: NF7406_high_22
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7406_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 312
Target Start/End: Original strand, 43059978 - 43060273
Alignment:
| Q |
20 |
taatgaacggtgcagctgttttcctctgttttgtatcaatatggatttttgtttcctgaaaatattgagatgttctttagannnnnnnattttattgcag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
43059978 |
taatgaacggtgcagctgttttcctctgttttgtatcaatatggatttttgtttcctgacaatattgagatgttctttagattttttt-ttttattgcag |
43060076 |
T |
 |
| Q |
120 |
aggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaatgcatccttat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43060077 |
aggtgtttttgttgagcaggctggaagtaatgtggcattatttttgcatcttttacaagttttaggatttttgtttaatttgttgcaaatgcatccttat |
43060176 |
T |
 |
| Q |
220 |
tgtgaagtgtgctctttttgtttat----gatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattcatgtgtgatgt |
312 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
43060177 |
tgtgcagtgtgctctttttgtttatataagatatttcttctgctgacaatgtgattaatttattggcgtttggcaagctcaaattaatttgtgatgt |
43060273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University