View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7406_high_31 (Length: 233)

Name: NF7406_high_31
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7406_high_31
NF7406_high_31
[»] chr5 (2 HSPs)
chr5 (106-220)||(35673149-35673263)
chr5 (20-49)||(35673075-35673104)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 106 - 220
Target Start/End: Original strand, 35673149 - 35673263
Alignment:
106 ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctcccacccaacctctctcttcccaccatccgccgatcctctccaaccacca 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35673149 ctctcaacttccaccgctgctgatgcactctcccgcctcctccaccgtctcccacccaacctctctcttcccaccatccgccgatcctctccaaccacca 35673248  T
206 cctctccttcttctc 220  Q
    |||||||| ||||||    
35673249 cctctcctccttctc 35673263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 49
Target Start/End: Original strand, 35673075 - 35673104
Alignment:
20 aaaaccttcatggtggaggctccacctcag 49  Q
    ||||||||||||||||||||||||||||||    
35673075 aaaaccttcatggtggaggctccacctcag 35673104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University