View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7406_low_2 (Length: 644)
Name: NF7406_low_2
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7406_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 367
Target Start/End: Original strand, 8764987 - 8765336
Alignment:
| Q |
18 |
gggaggatcttagggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgctttggaggtaatagatagatcttgt |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8764987 |
gggaggatctaagggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgctttggaggtaagagatagatcttgt |
8765086 |
T |
|
| Q |
118 |
taacttggccatgtttggtaactagaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcagccaggtatgggtctgccacgacg |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| | |
|
|
| T |
8765087 |
taacttggccatgtttggtaactggaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcatccaggtatgggtctgccgcgatg |
8765186 |
T |
|
| Q |
218 |
tcttgtaattttgggatgagagctaggtctctgaaatctccttcgccctggtggaaaaggggtttctttgctcggctccaagtcgaatttctcttcatat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8765187 |
tcttgtaattttgggatgagagctaggtccctgaaatctccttcgccctggtggaaaaggggtttctttgctcggctccaagtcgaatttctcttcagat |
8765286 |
T |
|
| Q |
318 |
tggtttgcagagggcttgtctcgagtggttcgggatggcaggaagatgtc |
367 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
8765287 |
tggtttgcagagggcttgtcttgagtggtttgggatggcaggaagatgtc |
8765336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 366 - 627
Target Start/End: Original strand, 8765625 - 8765886
Alignment:
| Q |
366 |
tctttccgctgcctcaattcaatagggtgggaagtctgaggcggttgttgacccggttgatctgatttggcatagttgggcaccctttaaagttaatcct |
465 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
8765625 |
tctttcagctgcctcaattcaattgggtgggaagtttgaggcggttgttgacccgcttgatctgatttggcatagttgggcaccctctaaagttcatcct |
8765724 |
T |
|
| Q |
466 |
gcaagttatcctcgatagggccccaactcgtcaaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaat |
565 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765725 |
gcaagttatcctcgatagggccccaactcgtcaaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaat |
8765824 |
T |
|
| Q |
566 |
gtggaatcagtggatcatctgtttgtcacttgtagggtggtgtccggtgtttggtatcgtgt |
627 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765825 |
gtggaatcagtggatcatctttttgtcacttgtagggtggtgtccggtgtttggtatcgtgt |
8765886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University