View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7406_low_33 (Length: 248)
Name: NF7406_low_33
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7406_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 45379077 - 45378847
Alignment:
| Q |
1 |
ggtcagagtttaaattcagatacctacttattgacctataaagatgaatttctaatcattaaactacttgattnnnnnnnnttatatatattttctagtc |
100 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
45379077 |
ggtcagagttcaaattcaaatacctacttattgacctaaaaagatgaatttctaaccattaaactatttgattaaaaaaaattatatatattttctagtc |
45378978 |
T |
 |
| Q |
101 |
tctattggtaataacatccactctaaaaagacaatcgaattttgtgaaacaaatgg-ttgaactttttaacaaatttaaagtcaataattttggtgataa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45378977 |
tctattggtaataacatccactctaaaa-gacaatcgaattttgagaaacaaatgggttgaactttttaacaaatttaaagtcaataattttggtgataa |
45378879 |
T |
 |
| Q |
200 |
gttatattcaaaacctttggaggactcaatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45378878 |
gttatattcaaaacctttggaggactcaatgt |
45378847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 71
Target Start/End: Original strand, 26560835 - 26560863
Alignment:
| Q |
43 |
gatgaatttctaatcattaaactacttga |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26560835 |
gatgaatttctaatcattaaactacttga |
26560863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University