View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7406_low_36 (Length: 217)

Name: NF7406_low_36
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7406_low_36
NF7406_low_36
[»] chr1 (1 HSPs)
chr1 (23-200)||(36642578-36642761)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 36642761 - 36642578
Alignment:
23 tgctggggttgaggctgctacaaatgatgatgggtacttttgagatgatgaaggacttggtattgg------caatgccaagtttgggaaataatgtgga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||      ||||||||||||||||||||||||||||    
36642761 tgctggggttgaggctgctacaaatgatgatgggtacttttgagatgatgaaggatttggtattggtattggcaatgccaagtttgggaaataatgtgga 36642662  T
117 taaaagaatggccatcgaatagatagcatagcatagagaccattatcattcaactagaatagaataataagggaggtaaaaggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36642661 taaaagaatggccatcgaatagatagcatagcatagagaccattatcattcaactagaatagaataataagggaggtaaaaggt 36642578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University