View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7406_low_36 (Length: 217)
Name: NF7406_low_36
Description: NF7406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7406_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 36642761 - 36642578
Alignment:
| Q |
23 |
tgctggggttgaggctgctacaaatgatgatgggtacttttgagatgatgaaggacttggtattgg------caatgccaagtttgggaaataatgtgga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36642761 |
tgctggggttgaggctgctacaaatgatgatgggtacttttgagatgatgaaggatttggtattggtattggcaatgccaagtttgggaaataatgtgga |
36642662 |
T |
|
| Q |
117 |
taaaagaatggccatcgaatagatagcatagcatagagaccattatcattcaactagaatagaataataagggaggtaaaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36642661 |
taaaagaatggccatcgaatagatagcatagcatagagaccattatcattcaactagaatagaataataagggaggtaaaaggt |
36642578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University