View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7408_low_16 (Length: 254)
Name: NF7408_low_16
Description: NF7408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7408_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 86 - 236
Target Start/End: Original strand, 7944247 - 7944397
Alignment:
| Q |
86 |
tctataataagaggagcattgaaatcatccaattttatttgtttcacatgcaaatagagttttattgccacatgtttcaaacatgatacattagattatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
7944247 |
tctataataagaggagcattgaaatcatccaattttatttgtttcacatgcaaatagagttttactgccgcatgtttcaaacatgatacattagattatt |
7944346 |
T |
|
| Q |
186 |
attagatttaatttctaatagatttaactactcataattggaattacaaat |
236 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7944347 |
ctcagacctaatttctaatagatttaactactcataattggtattacaaat |
7944397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 7943056 - 7943149
Alignment:
| Q |
1 |
ctatttataatcttcttccacctacaatgataaaactgatccaacacatgaattttcgtataagtaatgatctatctaatagacttctataata |
94 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7943056 |
ctatttataatattgttccacctataatgataaaactgatccaacacatgaattttcgtagaagtaatgatccatctaatagacttctataata |
7943149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University