View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7410_high_6 (Length: 304)
Name: NF7410_high_6
Description: NF7410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7410_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 11150855 - 11150578
Alignment:
| Q |
10 |
aatataacttctagataagtgatcaagtggggaaaagaagggcattgtatttcatcattttgagatagtttgtacaacacaatccaataacttagcaaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11150855 |
aatataacttctagataagtgatcaagtggggaaaagaagggcattgtatttcatcattttgagatagtttgtacaacacaatccaataacttagcaaaa |
11150756 |
T |
 |
| Q |
110 |
ccttttcatgttttttatttgtccactttccagatgctgcaaaagtagtgactgagatggcagataacactgattttctttgactgatactcacatttgc |
209 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11150755 |
ccttttcattttttttatttatccactttccagatgctgcaaaagtagtgactgagatggcagataacactgattttctttgactgatactcacatttgc |
11150656 |
T |
 |
| Q |
210 |
ttagccggggtcccttctcttttcgtatgtgaggtatgctctctatcaagatcttcttttcttctctcacacttttat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11150655 |
ttagccggggtcccttctcttttcgtatgtgagctatgctctctatcaagatcttcttttcttctctcacacttttat |
11150578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University