View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7411_low_11 (Length: 300)
Name: NF7411_low_11
Description: NF7411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7411_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 15 - 296
Target Start/End: Original strand, 24627867 - 24628147
Alignment:
| Q |
15 |
atgctatacgaatttctaaccaacatccgataaaattcaaccctaaccaaactaacaatagcaatcaatttgaacaaaacaccagtccgtaacactacaa |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24627867 |
atgccatacgaatttctaaccaacatccgataaaattcaaccctaaccaaactaacaatagcaatcaatttgaacaaaacaccagtccgtaacactacaa |
24627966 |
T |
 |
| Q |
115 |
caacggtcccttttatggtgctgagataaatatttcatccaattttcaccaacatcaaattcatcattcataacatagtttctatttttcttacttcaac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24627967 |
caacggtcccttttatggtgctgagataaatatttcatccaattttcaccaacatcaaattcatcattcataacatagtttct-tttttcttacttcaac |
24628065 |
T |
 |
| Q |
215 |
ttaatttacacgtgcagttaacttaatgacaaaccttaacctaactccatcatactcaaatcagccccctttcttctcactc |
296 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
24628066 |
ttaatttacacatgcagttaacttaatgacaaaccttaacctaactccatcaaactcaaatcagccccctttcttctaactc |
24628147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University