View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7411_low_16 (Length: 249)
Name: NF7411_low_16
Description: NF7411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7411_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 110 - 208
Target Start/End: Original strand, 14978062 - 14978160
Alignment:
| Q |
110 |
taaacagtcatcttggtctttaaatttgtgagacactgtcgcaatagtgcgacagtctttggatgtattgaaattaccacaagcatacctaaatgtgtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14978062 |
taaacagtcatcttggtctttaaatttgtgagacactgtcgcaatagtgcgacagtctttggatgtattgaaattaccacaagcatgcctaaatctgtc |
14978160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 14977951 - 14977991
Alignment:
| Q |
1 |
atggttattggtgatggtgtccttacacctgctctttcagg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14977951 |
atggttattggtgatggtgtccttacacctgctctttcagg |
14977991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University