View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7411_low_4 (Length: 412)
Name: NF7411_low_4
Description: NF7411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7411_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 18 - 388
Target Start/End: Complemental strand, 32387917 - 32387547
Alignment:
| Q |
18 |
cttcttaacacaaatccaacatgattcgccaaaaatcaattctctcatttttccataaaacctcgccggaaaatcgcacttccgccgccgcaaaaaccac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387917 |
cttcttaacacaaatccaacatgattcgccaaaaatcaattctctcattcttccataaaacctcgccggaaaatcgcacttccgccgccgcaaaaaccac |
32387818 |
T |
|
| Q |
118 |
cgctccgtccgctccgcaatccaaccccgaagatcgtactataaaaccagtcgtcaatccaccgccgccgtcagatgacgtcagaggaactgacactccg |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387817 |
cgctccatccgctccgcaatccaaccccgaagatcgtactatcaaaccagtcgtcaatccaccgccgccgtcagatgacgtcagaggaactgacactccg |
32387718 |
T |
|
| Q |
218 |
ccggagaaggtgccgcgtcaggttttaccggctaactacgtggcgaacacgaagaactcaggttcttgtttgtttgagagtatcatgcataagtttatta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387717 |
ccggagaaggtgccgcgtcaggttttaccggctaactacgtggcgaacacgaagaactcaggttcttgtttgtttgagagtatcatgcataagtttatta |
32387618 |
T |
|
| Q |
318 |
aggttgatgatggcgaaaaggttaaccagaggtcattatcgttttctttcttctttctaattttgtagttt |
388 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32387617 |
aggtcgatgatggcgaaaaggttaaccagaggtaattatcgttttctttcttctttctaattttgtagttt |
32387547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University