View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7411_low_6 (Length: 382)
Name: NF7411_low_6
Description: NF7411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7411_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 4513506 - 4513858
Alignment:
| Q |
19 |
cttcagagattcaaacattcacttcaataatgatgcttgattgacatataactacctcttagctctgacttaaatttccattcaatggaacagctgaagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513506 |
cttcagagattcaaacattcacttcaataatgatgcttgattgacatataactacctctgagctctgacttaaatttccattcaatggaacagctgaagc |
4513605 |
T |
|
| Q |
119 |
tttggcttcacaggttactcaagagcattatgacaggggactcatatacccgcctttcactaacatcagaaagatttcggcacacattgccgccaaagtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513606 |
tttggcttcacaggttactcaagagcattatgacaggggactcatatacccgcctttcactaacatcagaaagatttcggcacacattgccgccaaagtg |
4513705 |
T |
|
| Q |
219 |
gcaactaaggcttatgagcttggtgagcgttagttttccttttggttaaaaatttcannnnnnnnatgtttggctaaatatgtttttagtccttaaactg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513706 |
gcaactaaggcttatgagcttggtgagcgttagttttcgttttggttaaaaatttcattttttttatgtttggctaaatatgtttttagtccttaaactg |
4513805 |
T |
|
| Q |
319 |
tggtaatttttgcttttggtcccccannnnnnnnactcgtcttgtcacttcat |
371 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
4513806 |
tggtaatttttgcttttggccccccattttttttactcgtcttgtcacttcat |
4513858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 43431791 - 43431723
Alignment:
| Q |
174 |
ttcactaacatcagaaagatttcggcacacattgccgccaaagtggcaactaaggcttatgagcttggt |
242 |
Q |
| |
|
||||| |||||||||||||| || || ||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
43431791 |
ttcaccaacatcagaaagatatcagctcacatagctgccaaagttgctgctaaggcttatgagcttggt |
43431723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University