View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7411_low_9 (Length: 309)
Name: NF7411_low_9
Description: NF7411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7411_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 12 - 290
Target Start/End: Complemental strand, 5863629 - 5863350
Alignment:
| Q |
12 |
atatcaaaacattggccacaataggcattaacatgagttttaaggccacaccagtaacaccacgtagcccctaaatggaagtttcatgtgannnnnnnn- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5863629 |
atatcaaaacattggccacaataggcattaacatgagttttaaggccacaccagtaacaccacgtagcccctaaatggaagtttcatgtgattttttttt |
5863530 |
T |
|
| Q |
111 |
agggatatattattgcattaaatttactggaccaaccatccagagcataggtggttatttttcagcctcatgaaagatcatgaacaagatgaaaggctga |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5863529 |
agggatttattattgcattaaatttactggaccaaccatccagagcataggtggttatttttcagcctcatgaaagatcatgaacaagatgaaaggctga |
5863430 |
T |
|
| Q |
211 |
ggccaattgtgcagtgtagataaattacatttttctttaggttttgttttgtttcctcttatcacctcatacactgcata |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5863429 |
ggccaattgtgcagtgtagataaattacatttttcttcaggttttgttttgtttcctcttatcacctcatacactgcata |
5863350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University