View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_high_15 (Length: 341)
Name: NF7413_high_15
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 23 - 328
Target Start/End: Original strand, 3568674 - 3568979
Alignment:
| Q |
23 |
ggcgcatcagcagaatgatcttgctaactcggccaacatagcacatttagattatgagggcgtgcacagtgaggagcaacagctggttgcacgtgaggat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568674 |
ggcgcatcagcagaatgatcttgctaactcggccaacatagcacatttggattatgagggcgtgcacagtgaggagcaacagctggttgcacgtgaggat |
3568773 |
T |
|
| Q |
123 |
gctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatacatcctaacatccaacatgacat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3568774 |
gctgcccattcagatatctctatggcaaatctttaagcaacagtaacattcatgagattggttctaacaaggatatatatcctaacatccaacatgacat |
3568873 |
T |
|
| Q |
223 |
ggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaac |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
3568874 |
ggaacttgttggtaattcaggtaccgtcatgtctgaagatagtagcatgcttgcggttcaacctggttttttggcagatgatatagttcataatagtaac |
3568973 |
T |
|
| Q |
323 |
acaggt |
328 |
Q |
| |
|
|||||| |
|
|
| T |
3568974 |
acaggt |
3568979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 248 - 332
Target Start/End: Original strand, 18485273 - 18485357
Alignment:
| Q |
248 |
gtcatgtctgaagatagtagcatgcttgcggttcaacctgattttttggcagatgatatagttcattatagtaacacaggttctg |
332 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |||||| | || |||||| |||||||| |
|
|
| T |
18485273 |
gtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University