View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_high_24 (Length: 248)
Name: NF7413_high_24
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 42933804 - 42934035
Alignment:
| Q |
1 |
ctaattatgttcctttacgagaggatcttaattcatgg-caaacaatattaatataccgttgtctcctttaactttggagggtaacaataacgaagaaga |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42933804 |
ctaattatgttcctttacaagaggatcttaattcatgggcaaacaatattaatataccgttgtctcctttaactttggagggtaacaataaggaagaaga |
42933903 |
T |
 |
| Q |
100 |
cggtgaagaagatcaggaacgtgttggtgatgatcaaggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggataccaacagc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933904 |
tggtgaagaagatcaggaacgtgttggtgatgatcaaggaaatgatcagaaacccgtttttgacctaatcaatgaaatgaattctttggataccaacagc |
42934003 |
T |
 |
| Q |
200 |
agaagtagtattgatccggggcaccaggtttgtta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42934004 |
---agtagtattgatccggggcaccaggtttgtta |
42934035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University