View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_high_27 (Length: 236)
Name: NF7413_high_27
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 7419304 - 7419095
Alignment:
| Q |
12 |
gagatgaaacccaacccatataaaagtgtgagtgagagtcaacaaaaaataatgcgtgagttaaaattaataagaaaacctaaaccaaaccacttactta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419304 |
gagatgaaacccaacccatataaaagtgtgagtgagagtcaacaaaaaataatgcgtgagttaaaattaataagaaaacctaaaccaaaccacttactta |
7419205 |
T |
 |
| Q |
112 |
atttgcacttgaaagcaaagaaaattacggttata--cttctgatcaaaaagcaaaacaaactatttcttctctctctccataactaatttaagattctc |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7419204 |
atttgcacttgaaagcaaagaaaatta---ttatagtcttctgatcaaaaagcaaaacaaactatttcttctctctctccataactaatttaagattctc |
7419108 |
T |
 |
| Q |
210 |
gaagcttcttctt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7419107 |
gaagcttcttctt |
7419095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University