View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_high_29 (Length: 230)
Name: NF7413_high_29
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 8333279 - 8333479
Alignment:
| Q |
12 |
aagaatatggtggaaagtcagttcatggaagcgaagtcacataactcataggctaaggagggggcatcatagtaatggaccttccaaaagatcattatat |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8333279 |
aagaaaatggtggaaagtcagttcatggaagcgaagtcacataactcataggctaaggagggggcatcatagtaatggaccttccaaaagatcattatat |
8333378 |
T |
|
| Q |
112 |
ggtgcatttcaatattgagaaataatataatcatgctcttttttatgagtcgtggttaattgttgatcattgtcttatcgttcaacgttggaggcctttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8333379 |
ggtgcatttcaatattgagaaataatataatcatgctcttttttatgaatcgtggttaattgttgatcattgtcttatcgttcaacgttggaggcctttg |
8333478 |
T |
|
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
8333479 |
t |
8333479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University