View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_high_7 (Length: 448)
Name: NF7413_high_7
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 300 - 431
Target Start/End: Original strand, 12816365 - 12816496
Alignment:
| Q |
300 |
aaacgaatgttggatgcattttatatattcgtacaattgtaaaattgtctgttttcatttttaaaagtatttaatttgggttggacggtttcatgtcata |
399 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12816365 |
aaacgaatgttggatgcatttgatatattagtacaattgtaaaattgtctgttttcatttttaaaagtatttaatttgggttggacggtttcatgtcata |
12816464 |
T |
 |
| Q |
400 |
atcgtgcccaatttagaaactgcattaagaac |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12816465 |
atcgtgcccaatttagaaactgcattaagaac |
12816496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 219 - 303
Target Start/End: Original strand, 12816261 - 12816345
Alignment:
| Q |
219 |
aaatcgatttcattatgatgtttatttattttgtcgaaaatttcattatgctctattatcctcttaattgctacttttagcaaac |
303 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12816261 |
aaatcaatttcattatgatgtttatttattttgtcgaaaatttcattatgctctattatcctcttaattgctacttttagcaaac |
12816345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University