View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7413_low_25 (Length: 265)

Name: NF7413_low_25
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7413_low_25
NF7413_low_25
[»] chr3 (1 HSPs)
chr3 (12-250)||(51278566-51278804)


Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 51278566 - 51278804
Alignment:
12 atgaacatattgccaggtgcaccgaattgttgaactctaccgttcaaatatatctatatatacgtggtggtggagtgtgtgatgttacagcacgggattt 111  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||    
51278566 atgaacatattgtcaggtgcaccgaattgttgaactctaccgttcaaatatatctatatatacgtggtggtggagtgtgtgatgttacaacacaggattt 51278665  T
112 tgatcaaacaggtgatatgcattatagaaaaaacaggaaaaggaagatagtgagggaggtacggtacctttcgaccggcgattttgcaggaacgtctgcc 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
51278666 tgatcaaacaggtgatatgcattatagaaaaaacaggaaaaggaagatagtaagggaggtacggtacctttcgaccggcgattttgcaggaacgtctgcc 51278765  T
212 catacaaagaggagtggaagtccatatggttcttcttct 250  Q
    |||||||||||||||||||||||||||||||||||||||    
51278766 catacaaagaggagtggaagtccatatggttcttcttct 51278804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University