View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7413_low_28 (Length: 240)
Name: NF7413_low_28
Description: NF7413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7413_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 15184572 - 15184805
Alignment:
| Q |
1 |
ctaaattttaaattatttcaatatcaaatcaggtttaggtcttgcaaagtctaaccaataagagactattcccacccttgcttataatcaagataggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||| || ||||||| |||||| |||||||||||||||||||| |
|
|
| T |
15184572 |
ctaaattttaaattatttcaatattaaatcaggtttagatcttacaaagtctaaccaataacaggctattcctacccttacttataatcaagataggaga |
15184671 |
T |
 |
| Q |
101 |
gaga--ctataagtgca--------atatatatgttttaccattgtgtaaatcttcaaacacttagtttatgtatcaaatttcttcataacttcatctag |
190 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15184672 |
gagagactataagtgcagtatatatatatatatgttttaccattgtgtaaatcttcaaacacttagtttatgtatcaaatttcttcataacttcatctag |
15184771 |
T |
 |
| Q |
191 |
gtaactagcacaacactccatgcatggctgaaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15184772 |
gtaactagcacaacactccatgcatggctgaaat |
15184805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University