View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_17 (Length: 391)
Name: NF7415_high_17
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 218 - 284
Target Start/End: Complemental strand, 26574092 - 26574026
Alignment:
| Q |
218 |
tttgaaatgtgagttgaatttgatcaagactgtgtaaacacaatttggattttataatccaaaaaac |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26574092 |
tttgaaatgtgagttgagtttgatcaagactatgtaaacacaatttggattttataatccaaaaaac |
26574026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 201 - 283
Target Start/End: Complemental strand, 26573895 - 26573813
Alignment:
| Q |
201 |
attttagtgatttatggtttgaaatgtgagttgaatttgatcaagactgtgtaaacacaatttggattttataatccaaaaaa |
283 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| || || |||||||||||| | || | ||| ||||||| |||||| |
|
|
| T |
26573895 |
attttagtgatttataatttgaaatgtgagctgaatttaattaaaactgtgtaaacaaagttcgaattatataatctaaaaaa |
26573813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 316 - 373
Target Start/End: Complemental strand, 38279248 - 38279191
Alignment:
| Q |
316 |
ttggctggatcaaaattgagaaatcttagagacaatcaatttagtcccctccactttc |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38279248 |
ttggctggatcaaaattgagaaatcttagagacaatcaatttaatcccctccactttc |
38279191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 286
Target Start/End: Complemental strand, 38274025 - 38273944
Alignment:
| Q |
205 |
tagtgatttatggtttgaaatgtgagttgaatttgatcaagactgtgtaaacacaatttggattttataatccaaaaaacgt |
286 |
Q |
| |
|
||||||||||| |||| |||||| ||| |||||||||| |||||| ||||||| || ||| ||| ||||| ||||||||| |
|
|
| T |
38274025 |
tagtgatttataatttggaatgtgggttaaatttgatcataactgtgaaaacacagttcggactttttaatcaaaaaaacgt |
38273944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 72
Target Start/End: Complemental strand, 38277372 - 38277336
Alignment:
| Q |
36 |
ttggtgttcttgctttagcttccattgttattgtggt |
72 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
38277372 |
ttggtgttcttgctttagcttccgttgttgttgtggt |
38277336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 253 - 282
Target Start/End: Complemental strand, 35756398 - 35756369
Alignment:
| Q |
253 |
aaacacaatttggattttataatccaaaaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35756398 |
aaacacaatttggattttataatccaaaaa |
35756369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University