View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_21 (Length: 343)
Name: NF7415_high_21
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 332
Target Start/End: Complemental strand, 43294534 - 43294217
Alignment:
| Q |
16 |
atatgtatgaatgattcgtatataactaaagtggtagtaatgacaaaagagtagaggatgattcggtagttgacatgtcacagttattatgacacaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43294534 |
atatgtatgaatgattcgtatataactaaagtggtagtaatgacaaaagagtagaggatgattcggtagttgacatgtcacagttattatgacacaaatt |
43294435 |
T |
 |
| Q |
116 |
tccaatcccctgaactggaaatgtatttcacaagttaaatatatatgcgtgttgcagcagatatatcattcactcttttgacgattcgacgatgccatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43294434 |
tccaatcccctgaactggaaatgtatttcacaagttaaatatatatgcgtgttgcagcagatatatcattcactcttttgacgattcgacgaggccatca |
43294335 |
T |
 |
| Q |
216 |
ctcatcattcaactttgtccttccttcatcacatgaatgaaaattaatttt-----aataattaggtatttatttattttcctcaaatggctaaagtctt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43294334 |
ctcatcattcaactttgtccttccttcatcacatgaatgaaaattaattttaacgcaataattagg----tatttattttcctcaaatggctaaagtctt |
43294239 |
T |
 |
| Q |
311 |
gtttgttctttttatttttctt |
332 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43294238 |
gtttgttctttttatttttctt |
43294217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University