View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_24 (Length: 327)
Name: NF7415_high_24
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 32 - 318
Target Start/End: Complemental strand, 44910797 - 44910517
Alignment:
| Q |
32 |
tatgctgcaacagctttacttgggatgtgctatggagttcaatattctataatggtcccaactgtttctgagctttttggtttgaagcactttggtgtaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910797 |
tatgctgcaacagctttacttgggatgtgctatggagttcaatattctataatggtcccaactgtttctgagctttttggtttgaagcactttggtgtaa |
44910698 |
T |
 |
| Q |
132 |
taagtagcttcatgatgctaggaaatccaattggtgcccttcttttttctgttttccttgctggaaatttgtatgatactgaagcggcgaagcaaggaaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910697 |
taagtagcttcatgatgctaggaaatccaattggtgcccttcttttttctg------ttgctggaaatttgtatgatactgaagcggcgaagcaaggaaa |
44910604 |
T |
 |
| Q |
232 |
ctccacctgctacggtgcaaattgtttcagaatcacttttcttgttttggctggtgtatgtggaattggtaccattttgagtataat |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910603 |
ctccacctgctacggtgcaaattgtttcagaatcacttttcttgttttggctggtgtatgtggaattggtaccattttgagtataat |
44910517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 44909689 - 44909652
Alignment:
| Q |
173 |
cttttttctgttttccttgctggaaatttgtatgatac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44909689 |
cttttttctgttttccttgctggaaatttgtatgatac |
44909652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University