View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_38 (Length: 250)
Name: NF7415_high_38
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_38 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 33 - 250
Target Start/End: Original strand, 40837009 - 40837228
Alignment:
| Q |
33 |
aggaaatgacaacttgttccaagcttgggttcgtctggatctagtctcggtgattgggttatgagctcttgttgtgctactgtatatgaatttgatgcgt |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40837009 |
aggaaatgacaacttgttccaagcttgggttcgtctggatctagtctgggtgattgggttatgagctcttgttgtgctactgtttatgaatttgatgcgt |
40837108 |
T |
|
| Q |
133 |
ctccgatgcattggaccgcatggctagaaatggt--tgaatctactgctgttgtttgtcacagttaattgttggtacttgtatttgttggcaatcagatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40837109 |
ctccgatgcattggaccgcatggctagaaatggttgtgagtctactgttgttgtttgtcacagttaattgttggtacttgtatttgttggcaatcagatt |
40837208 |
T |
|
| Q |
231 |
cactcgtcataatcaagatc |
250 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40837209 |
cactcgtcataatcaagatc |
40837228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 44 - 111
Target Start/End: Complemental strand, 27931436 - 27931368
Alignment:
| Q |
44 |
acttgttccaag-cttgggttcgtctggatctagtctcggtgattgggttatgagctcttgttgtgcta |
111 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||| ||||||||||| | ||||||||||| |||| |
|
|
| T |
27931436 |
acttgttccaaatcttgggtttgtctggatctggtctcagtgattgggttctaagctcttgttgagcta |
27931368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University