View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_43 (Length: 239)
Name: NF7415_high_43
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 40837220 - 40837421
Alignment:
| Q |
1 |
atcaagatccggcggatccgatgcacatcaagtcaaacacctctaattttttgcaatttgacttcgcacatatgttggtttgttgagttgtgctagaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40837220 |
atcaagatccggcggatccgatgcacatcaagtcaaacacctctaattttttgcaatttgacttcgcacatatgttggattgttgagttgtgctagaagt |
40837319 |
T |
|
| Q |
101 |
gtgaggttgattgctatagattgggatttggggcttccataccatctagggttgttttttccattgcttacactcgaggttaggctttatgtccctttcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40837320 |
gtgaggttgattgctatagattgggatttggggcttccataccatctagggttgttttttcgattgctcacactcgaggttaggttttatgtccctttcg |
40837419 |
T |
|
| Q |
201 |
ac |
202 |
Q |
| |
|
|| |
|
|
| T |
40837420 |
ac |
40837421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University