View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_high_46 (Length: 234)
Name: NF7415_high_46
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_high_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 31439895 - 31440094
Alignment:
| Q |
17 |
ttggtggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaaaggtggtggtgcgatggatgtggaggtgcttttgg |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31439895 |
ttggcggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaaaggtggtggtgcggtggatgtggaggtgcttttgg |
31439994 |
T |
|
| Q |
117 |
cgccggagacgatggcaaggcttgagagtgatgaggagttcatggtttatgcttcttgtcagcagtgacacgtgggagaatgttggaagcgcgtaattgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31439995 |
cgccggagacgatggcaaggcttgagagtgatgaggagttcatggcctatgcttcttgtcagcagtgacacgtgggagaatgttggaagcgcgtaattgt |
31440094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University