View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7415_high_48 (Length: 219)

Name: NF7415_high_48
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7415_high_48
NF7415_high_48
[»] chr1 (1 HSPs)
chr1 (111-205)||(10752545-10752639)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 111 - 205
Target Start/End: Complemental strand, 10752639 - 10752545
Alignment:
111 gacagccaaaaaataccaacatagttaggctgtcnnnnnnnnnnnnnngagggaatagttgggatgtcttagtttgtcatacaatgctattgcac 205  Q
    ||||||||||||||||||||||||||||||||||              |||||||||||| ||||||||||||||||||||||||||||||||||    
10752639 gacagccaaaaaataccaacatagttaggctgtcttttttatttttttgagggaatagttaggatgtcttagtttgtcatacaatgctattgcac 10752545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University