View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_14 (Length: 462)
Name: NF7415_low_14
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 8e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 37434532 - 37434729
Alignment:
| Q |
18 |
tataggtatggagggaaaaagacaaggtggcagaggcattctcttacatttcctttggaggtggtagacatgg----atgccttggatagcctttgatac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
37434532 |
tataggtatggagggaaaaagacaaggtggcagaggcattctcttacatttcctttggaggtggtagacatggatggatgccttggatagcctttgttac |
37434631 |
T |
|
| Q |
114 |
aagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttctttttataagcatttgactgtggatatcaagaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434632 |
aagcggagggagctttctgttaaacaataggactatgatatgtttcagtgtactgcttggatttctttttataagcatttgactgtggatatcaagaa |
37434729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 274 - 456
Target Start/End: Original strand, 37434797 - 37434977
Alignment:
| Q |
274 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgtttagggggtttatatcacaccctctgaaatacgaccttttttctctgatagttact |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434797 |
aatattttagtgaaagggttagagtaaattgctgcttgggatgtttagggg-tttatatcacaccctctgaaatacgaccttttttctctgatagttact |
37434895 |
T |
|
| Q |
374 |
tgctcacacaatgaaatgtagccaaaaacaaaaagtaacaacaaatagaatattgatatttgacttatttttcatgtaattgt |
456 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37434896 |
tgctcacacaatgaaatgtagccaaaaac-aaaagtaacaacaaatagaatattgatatttgacttatttttcatgtaattgt |
37434977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 3e-24; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 27 - 108
Target Start/End: Original strand, 580816 - 580897
Alignment:
| Q |
27 |
ggagggaaaaagacaaggtggcagaggcattctcttacatttcctttggaggtggtagacatggatgccttggatagccttt |
108 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
580816 |
ggagggaagaagacaaggcagcaggggcattctcttacatttcctttggaggtggtcgacatggatgccttggagagccttt |
580897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 27 - 108
Target Start/End: Complemental strand, 591611 - 591530
Alignment:
| Q |
27 |
ggagggaaaaagacaaggtggcagaggcattctcttacatttcctttggaggtggtagacatggatgccttggatagccttt |
108 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
591611 |
ggagggaagaagacaaggcagcaggggcattctcttacatttcctttggaggtggtcgacatggatgccttggagagccttt |
591530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 109 - 183
Target Start/End: Original strand, 581026 - 581100
Alignment:
| Q |
109 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
581026 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
581100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 591401 - 591327
Alignment:
| Q |
109 |
gatacaagcggagggagctttctgttaaacaataggactatgatgtgtttcagtgtactgcttggatttcttttt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| | ||||| || | ||||||||||||||||||||||||| |
|
|
| T |
591401 |
gatacaagcggagggagctttctgttaatcaatagggccatgatatgctccagtgtactgcttggatttcttttt |
591327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University