View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7415_low_27 (Length: 342)

Name: NF7415_low_27
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7415_low_27
NF7415_low_27
[»] chr2 (1 HSPs)
chr2 (1-58)||(8520227-8520284)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 8520284 - 8520227
Alignment:
1 aagaaaaatctcaaggtagtcaattggtggaacagtagcgccaacataaccaattcgt 58  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
8520284 aagaaaaatctcaagatagtcaattggtggaacagtagcgccaacataaccaattcgt 8520227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University