View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_31 (Length: 324)
Name: NF7415_low_31
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 25 - 248
Target Start/End: Complemental strand, 1052224 - 1052001
Alignment:
| Q |
25 |
tgttatcctttagatatggtgatttacataaatacttttgtggtgaattttgttgggttggaaataagagtttttgtggtggagagacttgatgaaaatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1052224 |
tgttatcctttagatatggtgatttatataaatacttttgtggtggattttgttgggttggaaataagagtttttgtggtggagagacttgatgaaaatt |
1052125 |
T |
 |
| Q |
125 |
gatgtggggtgtgacactacttatgagtggtttcatgatgggtattagaatctgtaataaagatatttacatattctaataatgtggttacaagaagatt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1052124 |
gatgtggggtgtgacactacttatgagtggtttcatgatgggtattagaatctgtaataaagatatttacatattctaataatgtggttacaagaagatt |
1052025 |
T |
 |
| Q |
225 |
gaaagatggacaaagtgttatatt |
248 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1052024 |
gaaagatggacaaagtgttatatt |
1052001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 265 - 305
Target Start/End: Complemental strand, 1051912 - 1051872
Alignment:
| Q |
265 |
gcggatatcggtagttgggttagtggtcaatgggtcatgtg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1051912 |
gcggatatcggtagttgggttagtggtcaatgggtcatgtg |
1051872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 97 - 163
Target Start/End: Original strand, 6343302 - 6343368
Alignment:
| Q |
97 |
tttgtggtggagagacttgatgaaaattgatgtggggtgtgacactacttatgagtggtttcatgat |
163 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||| ||| |||| |||||||||| |||||| ||||| |
|
|
| T |
6343302 |
tttgtggtggagagacttggtgaaaattggtgtagggcgtgaaactacttatggatggttttatgat |
6343368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University