View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_35 (Length: 305)
Name: NF7415_low_35
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 15796496 - 15796774
Alignment:
| Q |
14 |
ttctccttaacttgtccaaccgggtaaataaaattagctgttaaattacaaactttggaaattataaccattcactttgacttccttcnnnnnnnnnnnn |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15796496 |
ttctccttaacttgtccaaccgggtaaataaaattagctgttaaattacaaactttggaaattataaccattcaatttgacttccttcaaaaaaaaataa |
15796595 |
T |
 |
| Q |
114 |
ncattcactttaagtaac----tattttgcattaaactctgaatcctatttgcctgattaaaacgacgcctttttatctttctttggacggaaacatgca |
209 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15796596 |
acattcactttaactaactaactattttgcattaaactctgaatcctatttgcctgattaaaacgacgccgttttatctttctttggacggaaacatgca |
15796695 |
T |
 |
| Q |
210 |
accaaggttctctgcatcatcataaggtcgtgctttatcattgaagtgcattaaaagaatgacattgtaagtgttaatt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15796696 |
accaaggttctctgcatcatcataaggtcgtgctttatcattgaagtgcattaaaagaatgacattgtaagtgttaatt |
15796774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University