View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_48 (Length: 245)
Name: NF7415_low_48
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 43294152 - 43294038
Alignment:
| Q |
1 |
ataccagtttctcatcaggatcacgataccccaaagagatagcaaattgtgatctacaaggctatattaaatgcaactttctgggagttattgataatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
43294152 |
ataccagtttctcatcaggatcacgataccccaaagagatagcaaattgtgatctacaaggctatattaaatgcaactttc----------tgatattgt |
43294063 |
T |
 |
| Q |
101 |
cttagctagctactactacattgta |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43294062 |
cttagctagctactactacattgta |
43294038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 181 - 236
Target Start/End: Complemental strand, 43294039 - 43293984
Alignment:
| Q |
181 |
tacatacttatagctcaaatttcaataacataaaatcaagtgttgacaacattgtc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43294039 |
tacatacttatagctcaaatttcaataatataaaatcaagtgttgacaacattgtc |
43293984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University