View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7415_low_53 (Length: 234)

Name: NF7415_low_53
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7415_low_53
NF7415_low_53
[»] chr3 (1 HSPs)
chr3 (17-216)||(31439895-31440094)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 31439895 - 31440094
Alignment:
17 ttggtggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaaaggtggtggtgcgatggatgtggaggtgcttttgg 116  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
31439895 ttggcggtgaggagtggtggtgcgaataagtttgatgggaagatgtcggcgtttccggggaggaaaggtggtggtgcggtggatgtggaggtgcttttgg 31439994  T
117 cgccggagacgatggcaaggcttgagagtgatgaggagttcatggtttatgcttcttgtcagcagtgacacgtgggagaatgttggaagcgcgtaattgt 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
31439995 cgccggagacgatggcaaggcttgagagtgatgaggagttcatggcctatgcttcttgtcagcagtgacacgtgggagaatgttggaagcgcgtaattgt 31440094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University