View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_54 (Length: 232)
Name: NF7415_low_54
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 10114325 - 10114217
Alignment:
| Q |
1 |
aaacaagtatttcactccacaagctcatattctcaatattgctcatatcaaagacacagttccaaaatcatttgaacaaaggagacattagcctaaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10114325 |
aaacaagtatttcactccacaagctcatattctcaatattgctcatatcaaagacacagttccaaaatcatttgaacaaaggacacattagcctaaaaca |
10114226 |
T |
|
| Q |
101 |
tacaatatc |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
10114225 |
tacaatatc |
10114217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 10120586 - 10120508
Alignment:
| Q |
1 |
aaacaagtatttcactccacaagctcatattctcaatattgctcatatcaaagacacagttccaaaatcatttgaacaa |
79 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10120586 |
aaacaagtattccactccacaagctcatattctcaatattgctcatatcaaagacacagttccagaatcatttgaacaa |
10120508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 10114151 - 10114111
Alignment:
| Q |
175 |
taaattagacaccttaatcgtttatgaaatcaaacaagaca |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10114151 |
taaattagacaccttaatcatttatgaaatcaaacaagaca |
10114111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University