View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7415_low_55 (Length: 230)
Name: NF7415_low_55
Description: NF7415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7415_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 15796519 - 15796387
Alignment:
| Q |
1 |
cccggttggacaagttaaggagaagaagcttgacacgaaatctttgcatgactttgtctgctgaatttaccaatccacgtgatttgtttatttctcttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15796519 |
cccggttggacaagttaaggagaagaagcttgacacgaaatctttgcatgactttatctgctgaatttaccaatccacgtggtttgtttatttctcttta |
15796420 |
T |
|
| Q |
101 |
caaaaacaatggttgtatagtattctcaaacac |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15796419 |
caaaaacaatggttgtatagtattctcaaacac |
15796387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University