View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_10 (Length: 367)
Name: NF7417_high_10
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 97 - 344
Target Start/End: Complemental strand, 1726990 - 1726740
Alignment:
| Q |
97 |
tgtattccataactacgcaaaacaagagattgaagtaggataacaaaattt-ataatactttctcttcctatccggtgcatcaaatgagttttaaacgtc |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||| ||| |||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1726990 |
tgtattccataactacacaaaacaagagattgaagtaggataagaaagttttataatactttgtcttcctatccaatgcatcaaatgagttttaaacgtc |
1726891 |
T |
|
| Q |
196 |
tacaatgcaataagtttaaaaaactagcattgatcaatcgataatcannnnnnngtcaactttaatgctcttggtc--taaatttaaaatgagagcaata |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| | ||||| |||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1726890 |
tacaatgcaataagtttaaaaaactagcattcatcaatcaacaatcatttttttgtcaactttaatactcttggtctttaaatttaaaatgagagcaata |
1726791 |
T |
|
| Q |
294 |
caatcgagggtcaataatactttgcataaaacttgttagataagtcaattt |
344 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1726790 |
caatcgagggtcaataatactttgcgtaaaacttgttagataagtcaattt |
1726740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 35 - 91
Target Start/End: Complemental strand, 1738341 - 1738285
Alignment:
| Q |
35 |
ttgtaactgtcttaatcttagaggccattcaatggaactccatacacaacttgtgtg |
91 |
Q |
| |
|
|||||| ||||||| ||| ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1738341 |
ttgtaattgtcttagccttgtaggccgttcaatggaactccatacacaactagtgtg |
1738285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University