View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_18 (Length: 270)
Name: NF7417_high_18
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 6597137 - 6597374
Alignment:
| Q |
7 |
tttggtggtgccttttaaatagtagcaagttaagagaccatgcaacataataaatctgaataatacagcatgttgagggtgaatgtcttagttattgttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
6597137 |
tttggtggtgccttttaaatagtagcaagtta-gagaccatgcaacataatgaatctgaatactacaacatgttgagggtgaatgttttagttattgttg |
6597235 |
T |
 |
| Q |
107 |
tattgttgattgttgattgttgcaactgcacaagctcaacaagaaggcgattggaacttatacaaaacaaccgttcgtgttcaaaatatattgggaggta |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6597236 |
tattg-------ttgattgttgcaactgcacaagctcaacaagaaggcgattggaacttatacaaaacaaccgttcgtgttcaaaatatattgggaggta |
6597328 |
T |
 |
| Q |
207 |
atagtgttcttgtggttcattgtcattcatcagacaatgatcttgg |
252 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6597329 |
atagtgttcttgtggttcattgccattcatcagacaatgatcttgg |
6597374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University