View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_21 (Length: 262)
Name: NF7417_high_21
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 32960037 - 32959812
Alignment:
| Q |
19 |
ttgtgaggcatatctaataggcagcaacacaactgataaagttacatttcactttaatcgtttaaactgtaaagtgtagaatgttgcaagaattgatttg |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32960037 |
ttgtgaggcatatctaataagcagcaacacaactgataaagttacatttcactttaatcgtttaaactgtaaagtgtagaatgttgcaataattgatttg |
32959938 |
T |
 |
| Q |
119 |
atacaaattctatgcagtctgtttctgctgcgtctatctttatattaatcagtaatgtggcacgattgtatgtgcttcttctgtcgtggttgactggctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32959937 |
atacaaattctatgcagtctgtttctgctgcgtctatcttgatattaatcagtaatgtggcacgattgtatgtgcttcttctgtcgtggttgactggctc |
32959838 |
T |
 |
| Q |
219 |
ttcattgttgatgaaagtgaagccac |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32959837 |
ttcattgttgatgaaagtgaagccac |
32959812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University