View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_26 (Length: 242)
Name: NF7417_high_26
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 6916684 - 6916461
Alignment:
| Q |
1 |
aaactacaattcttttttctagataactacccccaataaatttaggaccgtgtacttgaaaggccatatcattcagctgccttattgcccttgtatgtgt |
100 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916684 |
aaaccacaattcttttttccagataactacccccaaaaaatttaggaccgtgtacttgaaaggccatatcattcagctgccttattgcccttgtatgtgt |
6916585 |
T |
|
| Q |
101 |
ttatcaatcgggtctgtacatcatgagaaacacgtgaatgttccttatattccattgtgaattcaccctttccctgtgtcatcgaacgaatagccgtaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916584 |
ttatcaatcgggtctgtacatcatgagaaacacgtgaatgttccttatattccattgtgaattcaccctttccctgtgtcatcgaacgaatagccgtaga |
6916485 |
T |
|
| Q |
201 |
atacccaaacatattgttaagagg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6916484 |
atacccaaacatattgttaagagg |
6916461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 68 - 176
Target Start/End: Original strand, 15035941 - 15036049
Alignment:
| Q |
68 |
atcattcagctgccttattgcccttgtatgtgtttatcaatcgggtctgtacatcatgagaaacacgtgaatgttccttatattccattgtgaattcacc |
167 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
15035941 |
atcattcaggtgccttattgcccttgtatgcgtttaccaattgggtctgtacatcatgagaaacaggtgaatgttccttatattccattgtaaattcacc |
15036040 |
T |
|
| Q |
168 |
ctttccctg |
176 |
Q |
| |
|
||||||||| |
|
|
| T |
15036041 |
ctttccctg |
15036049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 173 - 224
Target Start/End: Original strand, 15036138 - 15036189
Alignment:
| Q |
173 |
cctgtgtcatcgaacgaatagccgtagaatacccaaacatattgttaagagg |
224 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15036138 |
cctgtgtcatcgaacgaagagctgtagagtacccaaacatattgttaagagg |
15036189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University