View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_27 (Length: 239)
Name: NF7417_high_27
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 49673211 - 49673424
Alignment:
| Q |
1 |
attgtggaagttaaagagtgaactacaacacactttcattagtgaatcacattacaatctctacctataaagtgggggattttcttgaaacttgttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49673211 |
attgtggaagttaaagagtgaagtacaacacactttcattagtgaatcacattacaatctctacctataaagtgggggattttcttg----------ctt |
49673300 |
T |
|
| Q |
101 |
attttccaccactgtttccgtatcttggctttgcaatacacaatgaacccccttttcattttcaaatcattaatattcttccagttactgcttgtttcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49673301 |
attttccaccactgtttccgtatcttggccttgcaatacacaatgaacccccttttcattttcaaatcattaatattcttccagttactgcttgtttcag |
49673400 |
T |
|
| Q |
201 |
ctcaagatggaggatgtccaacct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49673401 |
ctcaagatggaggatgtccaacct |
49673424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 224
Target Start/End: Original strand, 49723253 - 49723328
Alignment:
| Q |
152 |
cttttcattttcaaatcattaatattcttccagttactgctt---gtttcagctcaagatggaggatgtccaacct |
224 |
Q |
| |
|
||||||||||||||||||||| | |||| || | | ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49723253 |
cttttcattttcaaatcattacttttctccctgattatgcttcatgtttcagctcaagatggaggatgtccaacct |
49723328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University