View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_high_29 (Length: 232)
Name: NF7417_high_29
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 9985404 - 9985204
Alignment:
| Q |
18 |
agatgttatgttaatcccttcaagtataatgtttgtgcaagttatggcttcatcacaatgtaattgaattacatctttagcaatagatgttcctcttatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
9985404 |
agatgttatgttaatcccttcaagtataatgtttgtgcaagttatgtcttcatcacaatgtaattgaattgcatgtttagcaatagatgttcctcttatg |
9985305 |
T |
 |
| Q |
118 |
ttgcggaaagttacatcacttactttcactgcatatacactatcatatgggttgtattcttgatcaataatcactggattgtctgcttcaattagtataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985304 |
ttgcggaaagttacatcacttactttcactgcatatgcactatcatatgggttgtattcttgatcaataatcactggattgtctgcttcaattagtataa |
9985205 |
T |
 |
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
9985204 |
t |
9985204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University