View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_low_32 (Length: 234)
Name: NF7417_low_32
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 8536881 - 8537085
Alignment:
| Q |
19 |
aaaatatgtaatcaaagaaacaaaataagtaggtccacagttatagaaacggatgcaaagaaaattggtaaaaaactactaactataactgaatcagtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
8536881 |
aaaatatgtaatcaaagaaacaaaataagtaggtccacagttatagaaacggatgcaaagaaaattggtaaaaaactactaactataactaaaacagtat |
8536980 |
T |
|
| Q |
119 |
cttaatcaacctaaccatttcttttcatgcccaaagtagattcagtgatgctctcaagcttcttcaacatgttcacaaacacatatgtttcttcattctt |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8536981 |
cttaatcaacctaaccattttttttcatgcccaaagtagattcagtgatgctctcaagcttcttcaacatgttcacaaacacatatgtttcttcattctt |
8537080 |
T |
|
| Q |
219 |
ctcac |
223 |
Q |
| |
|
|||| |
|
|
| T |
8537081 |
gtcac |
8537085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University