View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_low_35 (Length: 226)
Name: NF7417_low_35
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 23229473 - 23229269
Alignment:
| Q |
1 |
attacctaatacaatgtcaaagatgtagaaagtttcataacatgtagtgggtatagtttgtctctaggacaaaaa--tgaaaatcatagagattgacact |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
23229473 |
attacctaatacaatgtcaaagatgtagaaagtttcataacatgtagtgggtatagtttgtctctaggacaaaaaaatgaaaatcatagagattgaaact |
23229374 |
T |
 |
| Q |
99 |
tcactgtctagtagttgaaggtcgacatatcctaataagttaggaaaatgtttgttaaatacctcaattaagagatagatagatatatgagaggctggtg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
23229373 |
tcactgtctagtagttgaaggtcgacatatcctaataagttcggaaaatgtttgttagatacctctattaagagata----gatatatgagaggctggtg |
23229278 |
T |
 |
| Q |
199 |
tgttagaag |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
23229277 |
tgttagaag |
23229269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University