View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_low_37 (Length: 202)
Name: NF7417_low_37
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1726562 - 1726728
Alignment:
| Q |
1 |
tttattgtaataattacttcaccaacaatgaataaaaagttattttgatcatttctaacatgtttttattattggatcaaaaagtcacatcatgtttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1726562 |
tttattgtaataattacttcaccaacaatgaataaaaagttattttgatcatttctaacatgtttttattattggatcaaaaagtcacatcatgtttgat |
1726661 |
T |
 |
| Q |
101 |
ttaatgataagttttattgatttaatagtaaaaactaacttgcgcatgatgcaaaatttgtttcact |
167 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1726662 |
ttaatgataagttttattgattcaatactaaaaactaatttgcgcatgatgcaagatttgtttcact |
1726728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 159
Target Start/End: Complemental strand, 13004779 - 13004719
Alignment:
| Q |
99 |
atttaatgataagttttattgatttaatagtaaaaactaacttgcgcatgatgcaaaattt |
159 |
Q |
| |
|
|||||||| |||| |||||||||||||| || ||||| |||||| | |||||||||||||| |
|
|
| T |
13004779 |
atttaatggtaaggtttattgatttaatggtgaaaacaaacttgtgaatgatgcaaaattt |
13004719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 38406419 - 38406472
Alignment:
| Q |
103 |
aatgataagttttattgatttaatagtaaaaactaacttgcgcatgatgcaaaa |
156 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |||||| | || |||||||| |
|
|
| T |
38406419 |
aatgataagatttattgattcaatagtaaaaacgaacttgtgtataatgcaaaa |
38406472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 167
Target Start/End: Original strand, 37439781 - 37439849
Alignment:
| Q |
99 |
atttaatgataagttttattgatttaatagtaaaaactaacttgcgcatgatgcaaaatttgtttcact |
167 |
Q |
| |
|
||||||| |||| |||||||||||||||||| |||||||||| | |||||| ||||| ||| ||||| |
|
|
| T |
37439781 |
atttaattataaaatttattgatttaatagtagaaactaacttatgtatgatgaaaaatatgtgtcact |
37439849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University