View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7417_low_8 (Length: 436)
Name: NF7417_low_8
Description: NF7417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7417_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 24 - 332
Target Start/End: Complemental strand, 26884303 - 26883995
Alignment:
| Q |
24 |
ggtgcgtggctttttctctacattctccaggcacccgagaagaaactcgtgatcctcgaccgtgtgttttcgaaaaatgagttgctggttgtgttgattg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26884303 |
ggtgcgtggctttttctctacattctccgggcacccgagaagaaactcgtgatcctcgaccgtgtgttttcgaaaaatgagttgctggttgtgttgattg |
26884204 |
T |
 |
| Q |
124 |
tagcaactgttgtggtggttgtgatgacgagcattgtgtcggtgattgtctatgctgtgatggtgggggtggggattgtgtgtgctcatggagcgatttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26884203 |
tagcaactgttgtggtggttgtggtgacgagcattgtgtcggtgattgtctatgctgtgatggtgggggtggggattgtgtgtgctcatggagcgatttg |
26884104 |
T |
 |
| Q |
224 |
tgttccagaggatttgttccttgaacaacaagaaccatggtcctggtattttggcctttttcccttagttgaaaatgggtccaaatctaggagttcatat |
323 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26884103 |
tgttccagaggatttgttccttgagcaacaagaaccatggtcctggtattttggcctttttcccttagttgaaaatgggtccaaatctaggagttcatat |
26884004 |
T |
 |
| Q |
324 |
gatcctaat |
332 |
Q |
| |
|
||||||||| |
|
|
| T |
26884003 |
gatcctaat |
26883995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University