View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7419_high_3 (Length: 240)
Name: NF7419_high_3
Description: NF7419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7419_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 34381018 - 34381167
Alignment:
| Q |
1 |
cctccagtggttcaacaaaatcaccttcagcagaatcatcatcagcgccggtttcagtttcagcagcgtcggcagtgggatcccaatcgagactcaatcc |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34381018 |
cctccggtggttcaacaaaataaccttcagcagaatca---tcagcgccggtttcagtttcagcagcgtcagcagtgggctcccaatcgagactcaatcc |
34381114 |
T |
|
| Q |
101 |
agcttcttcctctagagaagtggtgagtgtgtcgccttcttgagcaacgaata |
153 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381115 |
agcttcttcgtctagagaagtggtgagtgtgtcgccttcttgagcaacgaata |
34381167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University