View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7419_low_3 (Length: 240)

Name: NF7419_low_3
Description: NF7419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7419_low_3
NF7419_low_3
[»] chr3 (1 HSPs)
chr3 (1-153)||(34381018-34381167)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 34381018 - 34381167
Alignment:
1 cctccagtggttcaacaaaatcaccttcagcagaatcatcatcagcgccggtttcagtttcagcagcgtcggcagtgggatcccaatcgagactcaatcc 100  Q
    ||||| ||||||||||||||| ||||||||||||||||   ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||    
34381018 cctccggtggttcaacaaaataaccttcagcagaatca---tcagcgccggtttcagtttcagcagcgtcagcagtgggctcccaatcgagactcaatcc 34381114  T
101 agcttcttcctctagagaagtggtgagtgtgtcgccttcttgagcaacgaata 153  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
34381115 agcttcttcgtctagagaagtggtgagtgtgtcgccttcttgagcaacgaata 34381167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University